Mycobacterium tuberculosis ADN complexe d’un bison éteint daté, des années avant le présent

Afin d’évaluer la présence de la tuberculose dans le bison du Pléistocène et l’origine de la tuberculose en Amérique du Nord, des prélèvements d’ADN distincts ont été effectués par des laboratoires distincts sur des échantillons du métacarpe d’un bison à longues cornes éteintes daté au radiocarbone, ± ans auparavant. et qui ont eu des changements pathologiques suggestifs de la tuberculose amplification de réaction en chaîne de polymérase fragments isolés de l’ADN de la tuberculose, qui ont été séquencés, et sur lequel spoligotyping a également été réalisée pour aider à déterminer sa relation avec les divers membres du complexe Mycobacterium tuberculosis l’ADN du complexe tuberculosis a été utilisé, y compris l’analyse des spécimens paléontologiques et modernes dans des laboratoires géographiquement séparés

La reconnaissance d’une pathologie compatible avec la tuberculose dans les os des bovidés du Pléistocène nord-américain a suggéré que la tuberculose était présente très tôt sur ce continent. Ceci est confirmé par les résultats du séquençage d’ADN d’un échantillon d’un bison daté de plusieurs années. La présence d’une pathologie semblable chez le mouflon fossile et le bœuf musqué suggère que les organismes complexes de Mycobacterium tuberculosis étaient répandus chez les bovidés qui ont immigré en Amérique du Nord par le détroit de Béring et se sont répandus au Pléistocène supérieur. Il suggère une distribution holarctique et que les bovidés La clarification de l’histoire évolutionniste des maladies infectieuses offre une grande opportunité pour comprendre les facteurs qui ont créé les modèles épidémiologiques actuels. L’étude des lésions pathognomoniques chez les fossiles a permis de progresser dans cette entreprise , mais pour de nombreuses lésions spécifiques l’étiologie ne peut être déterminée La PCR et l’application des techniques de spoligotypage et de séquençage de l’ADN permettent de transcender cette limite, mais la sensibilité même de la PCR pose le défi supplémentaire de la contamination La résurgence de la tuberculose au cours des dernières années souligne les limites actuelles de son contrôle La connaissance de l’histoire évolutive et des susceptibilités aux antibiotiques du complexe M tuberculosis peut fournir des informations qui mèneront à: un meilleur contrôle dans le futur Le problème est complexe, cependant Les sondes d’ADN standard pour la tuberculose reconnaissent ce qu’on appelle le « complexe M tuberculosis » , qui consiste en M tuberculosis, Mycobacterium bovis, Mycobacterium africanum et Mycobacterium microti Le terme « complexe M tuberculosis » distingue ce groupe d’organismes du mycobisme saprophyte par exemple, les organismes du sol et les mycobactéries atypiques telles que Mycobacterium avium-intracellulare Une analyse supplémentaire est nécessaire pour distinguer les membres du complexe M tuberculosis Le spoligotypage distingue clairement la tuberculose M moderne des M bovis modernes et des mycobactéries complexes non-M tuberculosis Documentation du complexe M tuberculosis chez les humains des deux côtés de l’océan Atlantique qui ont vécu & gt; il y a des millénaires [, -] a conduit à beaucoup de spéculations sur ses origines. Ces travaux suggèrent qu’au moins certains des diagnostics présomptifs précédemment rapportés étaient exacts La présence du complexe M tuberculosis des deux côtés de l’Atlantique Les dates suggèrent qu’il est arrivé avec les premiers colons en Amérique du Nord ou était présent en Amérique du Nord quand ils sont arrivés. Cette dernière hypothèse est étayée par des preuves suggestives dans les fossiles de bovidés nord-américains L’un des résultats classiques de la tuberculose est l’arthrite sous-chondrale. Cette découverte, relativement spécifique au diagnostic de la tuberculose, est fréquente dans les os fossiles du Pléistocène supérieur en Amérique du Nord Cette étude a impliqué l’utilisation de techniques d’ADN moléculaire pour identifier la présence du complexe M tuberculosis dans un spécimen squelettique avec des lésions évocatrices de la tuberculose de Natural Trap Cave Wyoming Ce site unique était un danger inévitable sur une piste de jeu, fournir un échantillonnage non biaisé des nombreuses espèces passantes L’identification des fragments d’ADN a été faite par spoligotypage et détermination directe de la séquence d’ADN. L’analyse a été réalisée dans des laboratoires distincts du Département de Bactériologie, Royal Free Hospital et University College, Londres et Département de Parasitologie, Hebrew University, Jérusalem pour assurer la reproductibilité des résultats et éliminer la possibilité de contamination Nos résultats fournissent le premier diagnostic définitif du complexe M tuberculosis dans un fossile Ils suggèrent que les bovidés étaient les vecteurs qui transportaient l’organisme primordial qui a causé ce que nous appelons aujourd’hui la peste blanche: tuberculose

Méthodes

ostéopénie péri-érosive diminution de la densité osseuse autour de la zone touchée L’agent étiologique le plus probable de cette paléopathologie était M tuberculosisÉchantillons et témoins Deux échantillons distincts ont été prélevés dans la région de surface articulaire minée d’un métacarpe d’un bison Bison éteint éteint. antiquus qui était enfermé dans des sédiments datés par l’analyse du radiocarbone à, ± années BP Des zones distinctes de la lésion pathologique ont également été examinées Des témoins fossiles constitués d’os exempts de lésions provenant d’espèces Canis et d’espèces EquusExtrait d’ADN Deux extractions distinctes d’ADN ont été indépendamment analysées par des laboratoires géographiquement distincts La lyse cellulaire avec du thiocyanate de guanidinium et la capture de l’ADN sur silice ont été utilisées sur des échantillons non décalcifiés du laboratoire de Jérusalem et sur des échantillons décalcifiés du laboratoire de Londres Des précautions rigoureuses ont été prises dans les deux laboratoires pour éviter la contamination croisée. précautions, en Des échantillons de contrôle qui ne contenaient pas de matériau osseux et de matériau osseux provenant de régions non-lésionnelles et d’espèces non affectées ont été utilisés pour évaluer la contamination au cours des processus d’extraction et d’amplification. Des systèmes de PCR ont été utilisés dans les laboratoires Le laboratoire de Jérusalem a utilisé des amorces de la protéine ribosomale S pour amplifier un fragment d’ADN -bp: position ‘-TCGTCGGGACAAGATCAGTAAG-‘ avant et ‘-ATCGAGTGCTCCTGCAGGTTG-‘ position inverse – En outre, un amorceur basé sur la séquence d’insertion IS a également été utilisé pour amplifier une région de bp: forward ‘-CGTGAGGGCATCGAGGTGGC-‘ position – et inverser ‘-GCGACGTAGGCGTCGGTGACAAA-‘ position de l’amorceur -Le laboratoire de Londres a utilisé des amorces pour amplifier un segment plus petit à l’intérieur du SI Une PCR nichée en stades a été utilisée: la première réaction a amplifié une région -bp de IS , un da seconde réaction imbriquée amplifiée un segment interne -bp Ce dernier segment était comme suit: bases TTCGGACCACCAGCACCTAA – de X, aka IS et bases TCGGTGACAAAGGCCACGTA – de X, aka ISAmplification a été réalisée dans une solution de mM de pH Tris-HCL,, mM de NaCl, mM de phosphate de sodium, mM d’EDTA, mM de stabilisants dithiothréitol Sigma-Aldrich,% v / v de glycérol, mM de MgCl, pM de chaque amorce, mM chacun de triphosphates nucléaires MBI, Fermentas, et U de Platinum Taq ADN polymérase GibcoBRL Life Technologies L’amplification consistait en une dénaturation initiale à ° C pendant min, suivie de cycles de ° C pour s, ° C pour s, min à ° C, et, enfin, min à ° analyse de la séquence d’ADNc. Séquençage à l’aide du kit Amersham de Termo-Sequenase suivi d’une électrophorèse sur gel d’agarose du produit de PCR La bande a été découpée dans de la gélose à point de fusion Nu-Sieve et utilisée comme telle dans le mélange de marquage. et ext l’a fait en utilisant un kit MERinid Spin – des nucléotides; Anachem L’ADN purifié a ensuite été marqué par fluorescence avec le kit de séquençage ABI PRISM Dye Terminator Cycle avec AmpliTaq DNA Polymerase, PE PE Applied Biosystems La séquence a été analysée dans un séquenceur automatisé ABI PRISM PE Applied BiosystemsSpoligotyping Pour déterminer l’espèce de Mycobacterium dans le M tuberculosis complexe, le système de spoligotypage Isogen a été appliqué dans le laboratoire de Jérusalem « Spoligotyping » signifie « spacer-oligos » Le processus est basé sur l’amplification PCR d’une série de courtes séquences d’espacement non répétitives entre et bp, situé entre les petites répétitions DRs dans le DR locus du génome de Mycobacterium Ce système différencie M bovis moderne et M tuberculosis, comme démontré par le tableau des séquences oligonucléotidiques attachées à une membrane Les espaceurs sont disposés sur le tache dans l’ordre où ils apparaissent dans le HRV Les espaceurs de séquence DR -, -, et – et la séquence des espaceurs M bovis BCG, et – Le séquençage des régions DR des autres isolats de M tuberculosis, M bovis, M microti et Mycobacterium canetti a permis d’élucider de nouvelles séquences d’espaceur de M canetti L’ordre des espaceurs dans tous les isolats est très bien conservé, à l’exception de quelques duplications d’espaceurs [,, ] Une amorce est biotinylée, et les produits amplifiés sont hybridés dans des conditions stringentes à la membrane fournie dans le kit Isogen. La lecture finale est rendue extrêmement sensible par la liaison de streptavidine-peroxydase de raifort aux espaceurs hybrides biotinylés, suivie d’un chimiluminescent. Les résultats de spoligotypage similaires pour différentes extractions d’ADN peuvent impliquer un résultat précis basé sur les régions d’espacement du génome ou les régions d’espacement d’un motif cohérent de fragmentation, peut-être parce que la stabilité de la molécule varie à différents sites le long du brin d’ADN dermatologique. de cette technique à des spécimens anciens a été établie par Taylor et al.

Résultats

La récupération de l’ADN et le séquençage L’amplification PCR a permis la récupération du complexe M tuberculosis dans les deux laboratoires. Le séquençage a révélé que le produit de PCR obtenu appartenait à une espèce du complexe M tuberculosis Avec l’utilisation d’amorces pour le gène ribosomique S, les bandes de gel isolées match pour un fragment -bp du complexe M tuberculosis d’un séquençage bp IS éventuel a révélé une différence de substitution paire-base Le segment -bp de laboratoire de Londres avait une section -bp manquante – de X dans le brin avant, mais les séquences flanquantes de bp et bp étaient identiques à ceux dans la base de données Une séquence pour le brin inverse a été obtenue à partir des bases -, y compris la région manquante sur le brin positif. La longueur totale séquencée était bp, qui comprenait la longueur totale entre les amorces IS et IS noté dans le laboratoire de Jérusalem à T pour C Cependant, la séquence obtenue à Londres était d’accord avec celle de la base de donnéesExtraction control sampl Pour tous les autres échantillons d’os animaux et les spécimens de l’os affecté à des endroits éloignés des lésions, des extractions multiples et des analyses de séquençage PCR n’ont trouvé aucune preuve de tuberculose DNASpoligotypage Spoligotypage a révélé que le bison du Pléistocène les lésions contenaient des segments du complexe M tuberculosis non associés au M bovis moderne ou au M microti La présence d’espaceurs,,, et élimine la possibilité que l’ADN provienne du M bovis moderne ou du BCG apparenté , et donc élimine la possibilité que l’échantillon ait été contaminé par l’ADN d’un individu vacciné par le BCG Sur la base de l’identification du modèle de spoligotype en tant que nombre binaire -digit, on peut attribuer une nomenclature descriptive au modèle: prendre un négatif et positif et diviser le le motif en blocs ou en chiffres donne des blocs contenant des espaceurs -, -, -, -, et – Le nombre binaire dans chaque bloc peut ensuite être converti en base hexadécimale Le résultat est un code de × chiffres Le « code hex » pour le modèle de bison est donc FEEFF-DLe modèle de bison a été comparé à une base de données combinées de modèles rassemblés par l’Institut National de la santé publique et de l’environnement RIVM, Utrecht, Pays-Bas, et la Division des sciences vétérinaires, Département de l’agriculture et du développement rural, Belfast Le modèle ne correspondait à aucun modèle dans la base de données. similitudes au moyen du coefficient de Dice On a trouvé que le modèle de bison ressemblait le plus au modèle hexagonal FFEFFF, avec une similarité de%. Ce patron a été obtenu à partir de M isolats de tuberculose. Unités définies par l’espèce La similitude moyenne la plus élevée avec le patron de bisons a été obtenue à partir de l’unité M africanum%, suivie de M tubercul osis% et M bovis%; Par conséquent, le modèle de bisons s’intègre bien dans les unités M africanum et M tuberculosis Une étude plus poussée du modèle de spoligotype de bison par analyse discriminante montre que les diagrammes de bisons sont plus proches du groupe M tuberculosis que des groupes M bovis et M africanum L’analyse des composantes des modèles de spoligotypes dans la base de données, excluant les espaceurs qui étaient négatifs pour le modèle de bisons, montre que le modèle de bisons continue à se grouper avec M tuberculosis et M africanum plutôt qu’avec M bovis. M tuberculosis et M africanum ne sont pas liés à des difficultés pour obtenir un patron de spoligotype complet

Vue de la table largeTélécharger une similarité de similarité du modèle de spoligotype de bison avec une bibliothèque de modèles de spoligotype, divisée en unités basées sur speciesTable View largeTélécharger une similarité de similarité du modèle de spoligotype de bison avec une bibliothèque de modèles de spoligotype, divisée en unités basées sur les espèces

Figure Vue largeTéléchargement de la représentation pseudodimensionnelle de l ‘analyse discriminante des profils de Mycobacterium bovis, Mycobacterium tuberculosis et Mycobacterium africanum à partir d’ une base de données combinées de modèles modernes colligés par l ‘Institut national de santé publique et environnement RIVM, Utrecht, Pays – Bas et Vétérinaire Division des sciences, Belfast MTB, M tuberculosisFigure Voir grandDisplayTyposynthèse pseudodimensionnelle de l ‘analyse discriminante des profils de Mycobacterium bovis, Mycobacterium tuberculosis et Mycobacterium africanum à partir d’ une base de données combinées de modèles modernes collationnée par l ‘Institut national de santé publique et environnement RIVM, Utrecht, Pays-Bas, et la Division des sciences vétérinaires, Belfast MTB, complexe M tuberculosis

Figure Vue largeTélécharger la représentation pseudodimensionnelle de l ‘analyse des composantes principales des profils de Mycobacterium bovis, Mycobacterium tuberculosis et Mycobacterium africanum à partir d’ une base de données combinées de modèles modernes colligés par l ‘Institut national de santé publique et environnement RIVM, Utrecht, Pays – Bas et La division des sciences vétérinaires de Belfast analyse exclut les espaceurs absents du spoligotypage de l ‘ADN des bisons anciens, c. – à – d., et MTB, M tuberculosis complexFigure Voir la grandeDisque de téléchargement Représentation pseudo – dimensionnelle de l’ analyse des composantes principales de Mycobacterium bovis, Mycobacterium tuberculosis, et Modèles de spoligotypes de Mycobacterium africanum tirés d’une base de données combinées de modèles modernes rassemblés par l’Institut national de santé publique et d’environnement RIVM, Utrecht, Pays-Bas et la Division des sciences vétérinaires, Belfast Analysis exclut les espaceurs absents du spoligotypage de l’ADN des bisons anciens. rs,, -, et MTB, complexe M tuberculosis

Discussion

Il est clair, d’après la présence d’éléments d’espacement, que l’ADN du bison n’est pas moderne. M Bovis ADN Cependant, M bovis, M tuberculose, M africanum et M microti a probablement évolué à partir d’un précurseur de M tuberculosis ~, – ans BP , de sorte que l’échantillon de bison peut être représentatif du précurseur ou des espèces du groupe peu de temps après la spéciation. un microréseau d’ADN, dans lequel presque toutes les bases de lecture sont affichées, permettant une analyse globale des différences génétiques entre les substrats M tuberculosis, M bovis et BCG Le séquençage multilocus impliquait un degré élevé de conservation génétique entre M bovis et M tuberculosis Les nouveaux résultats suggèrent que la diversité génétique dans le complexe M tuberculosis peut être beaucoup plus grande que supposée précédemment et que la suppression des gènes, plutôt que n microti Van Soolingen et al ont démontré que M microti pouvait être reconnu et distingué sur la base des schémas de polymorphisme de longueur de fragment de restriction IS et au moyen de spoligotypage Bien que la mutation ponctuelle, peut être une source clé de variation génétique. La technique antérieure peut être d’une valeur limitée pour l’application à l’ADN ancien en raison des changements taphonomiques, les courtes régions de M microti à répétition directe identifiées par spoligotypage permettent sa reconnaissance et son élimination en tant qu’organisme responsable de la tuberculose chez le bison du Pléistocène. affectent les souris, il affecte les souris Isolement de M tuberculosis ADN complexe de la lésion seulement et non des espèces et des os non affectés suggère que la contamination du site par les souris est peu probable. Castets et al Il est responsable de% des cas de tuberculose en Afrique Hass et d es Prez se réfèrent à M africanum comme intermédiaire entre M tuberculosis et M bovis Les données de spoligotypage supportent ceci La relation éventuellement étroite entre l’organisme isolé et M africanum n’est donc peut-être pas surprenante Si le plus ancien organisme identifié dans cette étude est plus proche à M africanum qu’aux autres membres du complexe M tuberculosis, il semblerait raisonnable de considérer cet organisme comme la forme primordiale des organismes aujourd’hui reconnus comme M tuberculosis et M bovisM complexe tuberculosis Les amorces Eisenach / Taylor sont spécifiques du M tuberculosis Par conséquent, tout produit avec la PCR nichée est spécifique, comme cela est documenté par des études de séquençage. Il est intriguant que le modèle de spoligotypage de l’isolat de bison soit déterminé par comparaison avec la vaste collection de modèles de spoligotypage dans les données. les banques est plus proche du modèle de M africanum et M tuberculosis modernes que de la modèles des autres membres du complexe M tuberculosis Les profils ont été comparés à une base de données contenant plusieurs centaines de profils différents obtenus à partir d’isolats de M tuberculosis, & gt; M motifs bovis, M modèles microti et M modèles africains Le modèle obtenu à partir du matériel bison correspond le mieux à un modèle M tuberculosis. Cependant, le modèle bison correspond le mieux à la moyenne des modèles M africanum en tant que groupe. , cependant, ne peut pas être attribué à une espèce particulière du complexe M tuberculosis sur la base des données de spoligotypage L’assignation de cet isolat à l’une des espèces du complexe M tuberculosis doit être faite avec réserves, car la spéciation du complexe M tuberculosis peut pas encore passé par, années BP Le complexe M tuberculosis est très homogène au niveau de l’ADN et n’a pu spéculer que très récemment sur un organisme progéniteur Morsures La légère différence de paires de bases trouvée dans un laboratoire entre l’ADN ancien du bison spécimen et les séquences modernes nécessite une confirmation Il convient de noter qu’il n’y a eu aucun rapport de changements de base dans la séquence -bp de l’IS, bien que D’autres échantillons testés ont été considérablement moins anciens.Les différences entre les paires de bases fournissent une preuve supplémentaire que la contamination n’est pas un facteur critiqué par Kolman et Tuross parce que les chercheurs ont trouvé un ADN ancien dont les séquences étaient identiques à celles de l’ADN moderne. déclarent que «la découverte de séquences identiques dans un échantillon archéologique et l’échantillon d’ADN témoin exclut la preuve convaincante que l’ADN ancien a été extrait et analysé» [, p] L’absence de correspondance parfaite entre l’ADN extrait de l’ancien bison et l’ADN les organismes contemporains non seulement documentent l’absence de contamination, mais le caractère de cet ADN suggère qu’il peut représenter les organismes primordiaux qui se sont développés dans les organismes qui sont aujourd’hui utilisés comme contrôles positifs

Conclusion

Les conditions de la grotte de Natural Trap ont favorisé la conservation de l’ADN, car la température est restée presque constante et relativement basse, et le climat est semi-aride avec une faible circulation d’eau. M tuberculose Les bactéries complexes ont des parois cellulaires hydrophobes, riches en acides mycoliques à longue chaîne. La localisation dans les os assure une protection supplémentaire de l’ADN contre les pertes taphonomiques Comme cette documentation concerne la tuberculose au Pléistocène longtemps avant la domestication des bovins, elle suggère un scénario différent. La présence de lésions caractéristiques chez le mouton Ovis canadensis catclawensis et chez le bœuf musqué éteint Bootherium bombifrons et chez le bison – maintenant confirmée comme étant d’origine tuberculeuse – indique que la maladie était répandue tout au long du Pléistocène. On suggère que la tuberculose chez les bovidés un modèle holarctique et qu’il a atteint l’Amérique du Nord au moins, années BP Absence de lésions tuberculeuses chez les antilocapres Antilocapra americanum et Equus suggère qu’il était absent en Amérique du Nord avant l’immigration des bovidés avancés du nordAnalyse des spécimens supplémentaires qui ont des lésions tuberculeuses est maintenant indiqué pour élucider l’évolution de la tuberculose Il est probable que l’isolat de bison contient des espaceurs de spoligotypage «nouveaux» – et peut-être des espaceurs non encore identifiés – entre les espaceurs apparus sur la tache pour notre spécimen. Le dossier paléontologique fournit une excellente localisation géographique et chronologique. base de données pour comprendre les origines et la propagation des maladies, en particulier pour les maladies ayant un impact osseux important

Remerciements

Le soutien du Centre pour l’étude des maladies émergentes, Jérusalem, est grandement apprécié. La contribution de Dr Dick van Soolingen est reconnue avec gratitude