Une nouvelle approche pour un vaccin contre la maladie de Lyme

Un seul antigène recombinant de la protéine A OspA de surface externe conçu pour contenir des éléments protecteurs de différents sérotypes OspA et capable d’induire des réponses anticorps qui protègent les souris contre l’infection par sérotype Borreliaburgdorferi sensu stricto OspA ou Borrelia afzelii OspA- Protection contre l’infection par B burgdorferi La souche ZS a été démontrée dans un modèle de provocation par aiguille. La protection contre les espèces B afzelii a été démontrée dans un modèle de test de tiques utilisant des tiques sauvages. Dans les deux modèles, aussi peu que μg d’antigène. adjuvant, était suffisant pour fournir une protection complète contre les espèces ciblées Cette étude de preuve de principe prouve que la connaissance des épitopes protecteurs peut être utilisée pour la conception rationnelle de vaccins génétiquement modifiés efficaces nécessitant moins d’antigènes OspA et suggère que cette approche peut faciliter le développement de un vaccin OspA pour une utilisation mondiale

La maladie de Lyme, la maladie humaine transmise par les tiques la plus fréquente dans l’hémisphère nord, est causée par des bactéries appartenant au complexe Borrelia burgdorferi sensu lato sl Bien qu’il y ait au moins des espèces désignées dans ce groupe, la plupart des maladies humaines sont causées par des espèces: B burgdorferi sensu stricto ss, B afzelii et B garinii Toutes les espèces sont présentes en Europe, mais seules ces espèces B afzelii et B garinii sont présentes en Asie et seul B burgdorferi ss se trouve aux États-Unis. Essais cliniques aux États-Unis [, ] a montré que la maladie de Lyme pouvait être évitée par la vaccination avec OspA, un antigène majeur de surface codé par toutes les espèces B burgdorferi sl. Cependant, OspA est antigéniquement hétérogène et au moins les sérotypes OspA sont associés aux espèces B burgdorferisl trouvées en Europe . association entre le sérotype OspA et les espèces; Étant donné que l’immunité protectrice contre l’OspA est largement spécifique au type, un candidat vaccin conçu pour conférer une large protection contre la maladie de Lyme à l’échelle mondiale doit contenir plusieurs variants antigéniques de l’OspA . objectif de la présente étude de développer une nouvelle lipoprotéine OspA stable, sûre et immunogène, ainsi qu’une molécule capable de générer des anticorps avec des spécificités protectrices plus larges que les antigènes OspA présents dans la nature. Conception rationnelle d’OspA efficace et génétiquement modifié Les vaccins nécessitent la connaissance des épitopes protecteurs tels que ceux définis par l’anticorps monoclonal LA-, un anticorps utilisé pour prédire les réponses immunitaires protectrices dans les essais cliniques [,,] La cristallographie aux rayons X et les analyses par résonance magnétique nucléaire ont cartographié – epitope aux boucles exposées à la surface du domaine carboxy-terminal de l’OspA Cette information a été utilisée pour concevoir un Osp recombinant. Une molécule rOspA / comprenant la partie proximale d’une molécule de sérotype OspA avec la partie distale d’une molécule de sérotype OspA dans le but de combiner les propriétés protectrices des deux polypeptides parents dans une seule molécule Figure A, cellule T arthritogène présumée L’épitope OspA simulant l’antigène associé à la fonction leucocytaire humaine – hLFA – a été identifié pour le sérotype B burgdorferi ss Cet épitope YVLEGTLTA est absent de la nouvelle molécule OspA rOspA /, puisque la séquence dans cette région du sérotype- L’antigène OspA a été remplacé par une séquence non-hLFA correspondante d’une molécule de sérotype-OspA. Il a été prédit que la vaccination avec ce nouvel antigène serait capable de protéger contre l’infection par B burgdorferi ss et B afzelii de Borrelia, qui expriment le sérotype OspA – et des molécules de sérotype OspA, respectivement

Figure Vue largeDisque de téléchargement La partie proximale d’une séquence de sérotype-OspA de couleur verte est fusionnée à la partie distale d’une séquence de sérotype-OspA couleur rouge La molécule composite résultante contient la première des boucles exposées à la surface reconnues par le mAb de protection LA- et les troisièmes boucles reconnues par LA- sont remplacées par des séquences équivalentes de la molécule sérotypique. L’épitope hLFA- dans la feuille bêta de la séquence sérotypique a été remplacé par une séquence bêta de séquence d’acides aminés et partiellement dérivé de la séquence serotype Voir grand La partie proximale d’une séquence de sérotype-OspA de couleur verte est fusionnée à la partie distale d’une séquence rouge de sérotype-OspA La molécule composite résultante contient la première des boucles exposées à la surface reconnues par le mAb protecteur LA- Les deuxième et troisième boucles reconnus par LA- sont remplacés par des séquences équivalentes à partir de la molécule sérotype L’épitope hLFA- dans la feuille bêta du sérotype-seq a été remplacé par une séquence bêta de séquence d’acides aminés, et partielle de la séquence sérotypique

Méthodes

Conception et construction de rOspA /

Pour éliminer le risque d’introduction d’agents adventifs, des oligonucléotides synthétiques complémentaires chevauchants ont été utilisés pour générer des fragments d’ADN ligaturés et clones dans le vecteur pETa et la séquence a été vérifiée. Cette approche a également permis d’optimiser l’utilisation des codons pour l’hôte Escherichia coli. pour exprimer le gène ospA Le nouveau gène est basé sur la partie proximale d’une séquence serotype-OspA aa, souche B; Le numéro d’accès GenBank X fusionné à la partie distale d’une séquence de sérotype aa à, souche PKo; numéro d’accès S Le fragment d’acide aminé de B burgdorferi ss souche B aa à -GYVLEGTLTAEKTTLVVKEGTVTLS a été remplacé par séquence de B afzelii souche PKo aa à NFTLEGKVANDKVTLEVKEGTVTLS La séquence N-terminale incluant la séquence leader et les premiers acides aminés ont été dérivés de la souche OspB B; Numéro d’accession GenBank X afin d’optimiser l’expression de la protéine lipidée D’autres modifications spécifiques des acides aminés ont été apportées pour améliorer l’immunogénicité et la stabilité conformationnelle de la rOspA / molécule

Tests sur des animaux

La capacité d’une seule rOspA / à prévenir l’infection par des espèces de Borrelia, exprimant différents antigènes OspA, a été évaluée chez des souris CH / HeJ immunisées par voie sous-cutanée et avec des antigènes OspA recombinants purifiés ou des doses de μg formulées avec de l’hydroxyde d’aluminium comme adjuvant Les souris ont été stimulées des semaines après l’immunisation de rappel, soit par injection intradermique par injection d’aiguille; Pour ces dernières expériences, des tiques nymphales ont été appliquées par souris et laissées se nourrir pendant plusieurs jours. Les nymphes ont été collectées dans les environs de Budweis en République tchèque, une zone endémique de la maladie de Lyme. Données PCR non montrées Le statut infectieux des souris a été déterminé des semaines plus tard, comme indiqué dans la section Procédures diagnostiques. Dans les expériences de provocation par tique, la présence de Borrelia a été détectée. Les expériences sur les animaux ont été menées conformément aux lois autrichiennes sur l’expérimentation animale et aux directives internationales AAALAC et OLAW et ont été examinées par le Comité institutionnel de soins et d’utilisation des animaux et approuvées par les autorités de régulation autrichiennes

Immunogénicité

La réponse en anticorps μg IgG / mL à rOspA / antigène a été déterminée par ELISA en utilisant rOspA / comme antigène de revêtement et un anticorps monoclonal spécifique à OspA préparé en interne avec une teneur en IgG définie comme standard

Procédures de diagnostic

Pour les expériences de provocation par aiguille, la présence d’anticorps dirigés contre un épitope conservé dans la lipoprotéine VlsE exposée à la surface de la protéine C ELISA; On a utilisé un transfert de Western pour le diagnostic de l’infection. Le Western Blot a utilisé un lysat cellulaire préparé à partir de la souche ZS de B burgdorferi ss, car c’était l’organisme de défi. Les animaux ont été considérés comme infectés s’ils étaient infectés par le virus de l’immunodéficience humaine. ont été positifs dans les deux essais constitutionnel. Pour les essais de tiques, le test ELISA et le transfert Western ont également été effectués. Cependant, le transfert de Western a utilisé des lysats de B burgdorferi ss ZS, B afzelii ACA et B garinii KL car l’identité de l’organisme infectant était inconnue. En outre, l’infection à Borrelia a été évaluée par culture à partir de la vessie et par détection des acides nucléiques B burgdorferi sl dans l’ADN génomique extrait du tissu cardiaque en utilisant un test de PCR en temps réel ciblant la vessie. ‘-région d’ospA et un test basé sur le gène S rRNA Pour ce dernier test, l’amorce avant’ -GGATATAGTTAGAGATAATTATTCCCCGTT TG et l’amorce inverse «-CATTACATGCTGGTAACAGATAACAAGG ont amplifié un fragment de paire de bases qui a été détecté avec une sonde TaqMan®» -FAM- ACAGGTGCTGCATGGT-MGB; Applied Biosystems Les animaux ont été notés PCR positifs uniquement si un produit PCR a été détecté avec les deux tests Globalement, pour juger un animal infecté, les souris devaient être positives soit par culture, soit par PCR, soit par sérologie

Caractérisation de l’infection de Borrelia

Dans la mesure du possible, l’organisme infectant a été cultivé et la séquence OspA et la séquence d’acides aminés déduite ont été déterminées pour les résidus OspA – B afzelii VS, numéro d’enregistrement GenBank Z Cette information a été comparée aux séquences de référence OspA afin de pouvoir déduire le type OspA et Borrelia Pour les espèces qui expriment un seul sérotype OspA, la séquence OspA pour la souche de type pour l’espèce a été choisie comme référence, par exemple, B afzelii VS ou Borrelia valaisiana VS numéro d’accès GenBank Z; AF Comme B garinii a plusieurs types OspA, des séquences OspA pour les génotypes ospA – ont été utilisées, à savoir, les souches PBr, PTrob, WABSou, TlsI et T GenBank, respectivement X, X, X, X et X, pour le typage OspA en utilisant la PCR en temps réel, des tests spécifiques au sérotype ont été développés sur la base de l’analyse de séquences nucléotidiques connues et codant pour tous les sérotypes connus d’OspA A cette fin, des ensembles d’amorces et de sondes spécifiques ont été conçus. détection des souches sérotypiques OspA fwd-O: ‘-CAATGAAAAAGGTGAATTGTCTGC; rev-O: ‘-CATTTCTGTATATTCAAGTTTGGTTCCA; Sonde-O: ‘-NED-AAA ACCATGACAAGAGAAA – Souches de type MGB et OspA fwd-O:’ – CGCCGTCAGCAGTTAGAGTTC; rev-O: ‘-ATGGATCCGGAAAAGCTAAAGAA; Des essais de sonde-O: ‘-NED-TTCAAGAGTAAGGCTTT-MGBAll ont été effectués sur une unité de détection de séquence ABI Prism HT en utilisant des conditions de cycle universelles.

RÉSULTATS

Prévention du sérotype Borrelia burgdorferi ss OspA – Infection par immunisation avec rOspA /

Toutes les souris immunisées avec de faibles doses de différents lots de l’antigène rOspA / antigène ont développé des anticorps IgG spécifiques de l’immunogène tels que déterminés par ELISA Tableau Aucun anticorps n’a été détecté chez les souris témoins qui avaient été traitées avec un tampon de formulation de vaccin contenant de l’hydroxyde d’aluminium. capacité de cette réponse immunitaire à prévenir l’infection par B burgdorferiss, une espèce qui code pour un sérotype-OspA, les souris ont été injectées par voie intradermique avec des cellules x de B burgdorferiss souche ZS Toutes les souris témoins traitées avec un tampon contenant un adjuvant ont montré des signes sérologiques d’infection. démontrée par C ELISA et par Western blot Aucune des souris immunisées avec l’antigène rOspA / antigène n’a été infectée et les sérums de ces souris étaient négatifs par les deux dosages. Tableau Aussi peu que μg de l’antigène rOspA / antigène, formulé avec de l’hydroxyde d’aluminium comme adjuvant et administré dans un régime d’immunisation-dose, conféré% de protection P & lt; , Test exact de Fisher contre une provocation à l’aiguille avec la souche virulente B burgdorferiss ZS

Le tableau rOspA / est immunogène et protège les souris contre l’infection par la souche Z burgdorferiss ZS dans un modèle de traitement à l’aiguille. Traitement: gamme Doseb GMTc Contrôle du taux d’infection & lt; d / rOspA / lot – / * rOspA / lot – / * rOspA / lot – / * rOspA / lot – / * Treatmenta Doseb Gamme GMTc Contrôle du taux d’infection & lt; d / rOspA / lot – / * rOspA / lot – / * rOspA / lot – / * rOspA / lot – / * NOTE GMT, titre moyen géométrique; * P & lt; ; Les souris testaCH / HeJ à queue exacte de Fisher ont reçu différents lots de rOspA / antigène dans un régime de dose de rOspA / antigène, formulé avec% AlOH w / v, par mousecμg, rOspA / IgG spécifique / ml comme déterminé par ELISAdTiter déterminé par ELISA pour pool de sérum préparé pour les animaux témoins

Prévention du sérotype Borrelia afzelii OspA – Infection par immunisation avec rOspA /

Pour évaluer la capacité de l’immunisation avec le rOspA / antigène à prévenir l’infection par B afzelii, une espèce qui code pour un sérotype-OspA, des souris ont été immunisées, dans des expériences séparées, avec les mêmes lots d’antigènes et le même protocole d’essai. expérimentation décrite ci-dessus Cependant, dans ce cas, les souris immunisées ont été provoquées par des tiques virales nymphes connues pour être infectées principalement par B afzelii. La capacité de ces tiques sauvages à transmettre B. burgdorferi sl à des souris a été confirmée par des animaux témoins non immunisés. Total des souris témoins /,% infecté Tableau Tous les animaux témoins infectés étaient positifs pour l’ADN de Borrelia par des tests PCR en temps réel indépendants S ARNr et gènes ospA Dans certains cas, il était possible d’isoler Borrelia par culture de la vessie. positif par sérologie et PCR Pour les isolats de culture, les séquences OspA ont été récupérées et toutes ont été typées comme identité de séquence B afzelii & gt;% OspA. Les organismes pathogènes ont été typés B afzelii par analyse PCR de l’ADN extrait du cœur en utilisant un test PCR en temps réel ciblant spécifiquement les gènes sérotype-ospA. Ces données confirment que B afzelii était la principale espèce Borrelia transmise des tiques sauvages infectées à leurs hôte de souris

Tableau Immunisation avec rOspA / Protège contre l’infection par B afzelii transmis par la tique Nombre d’échantillons positifs Infecting Borrelia sp Traitementa Doseb SC PCR Culture Totalc B afzelii Autre Borrelia sp Contrôle / / / / / Aucune rOspA / / / / / / B garinii rOspA / / / / / / B garinii, B valaisiana Nombre d’échantillons positifs Infecting Borrelia sp Traitementa Doseb SC PCR Culture Totalc B afzelii Autre Borrelia sp Contrôle / / / / / Aucune rOspA / / / / / / B garinii rOspA / / / / / / B garinii, B valaisiana NOTE SC, souris séroconversionaCH / HeJ ont reçu différents lots de rOspA / antigène dans un régime -dose de doseb0g rOspA / antigène, formulé avec% AlOH w / v, par moustiqueNombre d’animaux réputés infectés Voir Résultats pour plus de détailsVoir LargeFew de la Des souris immunisées avec rOspA / total /,% sont devenues infectées. Tableau De ces souris, a été infecté tel que déterminé par tous les critères diagnostiques, sérologie, PCR et culture, et séquence l’analyse a révélé que l’organisme infectant était sérotype B garinii% identité de séquence OspA Les animaux restants jugés infectés étaient positifs uniquement par les critères Une souris était positive par sérologie et PCR Cependant, l’organisme infectant n’a pas pu être récupéré en culture. cet organisme pourrait être typé sérotype B garinii par analyse PCR de l’ADN extrait du coeur en utilisant une PCR spécifique du gène sérotype-ospA La troisième souris était PCR et culture positive, mais sérologiquement négative L’isolat cultivé à partir de cette souris était B Valaisiana comme déterminé par séquençage Identité de la séquence OspA avec la souche B valaisiana VS Fait important, aucune des souris immunisées / n’a été infectée par B afzelii Tableau Aussi peu que μg de l’antigène rOspA / antigène, lorsqu’il est formulé avec de l’hydroxyde d’aluminium comme adjuvant et administré dans -dose régime de vaccination, conféré protection complète Tableau contre B afzelii transmis par les tiques sauvages

DISCUSSION

Les vaccins humains pour la prévention de la maladie de Lyme ne sont pas disponibles A ce jour, les protéines vectorielles et plusieurs protéines de la membrane externe ont été explorées comme candidats vaccinaux dont OspA est l’antigène spirochétal le plus étudié et testé dans les essais cliniques de phase. Des études ont montré qu’un AP-épitope OspA est en corrélation avec l’immunité protectrice après vaccination et que des titres d’anticorps sériques équivalents LA prévoient une protection contre la transmission de l’infection par les tiques Cette étude a montré qu’il est possible Molécule d’OspA avec un epitope LA- altéré A cette fin, un seul antigène OspA recombinant a été produit qui comprenait la partie proximale d’une sérotype-souche dépourvue d’un epitope arthritogène putatif et la partie distale d’une souche serotype-Cet antigène recombinant OspA rOspA / est immunogène et capable de prévenir l’infection par des souches de B burgdorferi sl exprimant soit un sérotype B burgdorfer Comme prévu, la protection conférée par ce nouvel antigène ne s’étendait pas à d’autres espèces de Borrelia comme en témoigne l’incapacité de l’antigène à fournir une protection contre l’infection par les souches B garinii et B valaisiana. , cette étude de preuve de concept indique qu’il devrait être possible de concevoir d’autres nouvelles molécules OspA qui protègeront contre les autres espèces de Borrelia qui provoquent des maladies humaines et faciliteront le développement d’un vaccin à usage mondial Potentiellement, un vaccin contenant d’autres antigènes recombinants OspA pourrait également fournir une protection contre l’infection par B garinii, une cause majeure de neuroborréliose Un vaccin combiné basé sur cette stratégie nécessiterait moins d’antigènes OspA que nécessaire en utilisant des molécules OspA « natives » et potentiellement réduire la quantité d’antigène nécessaire pour la vaccination. Cette étude prouve que la connaissance des épitopes protecteurs peut être utilisée pour le rati Conception de vaccins efficaces génétiquement modifiés Nous remercions Marie Luise Zips, Doris Trzil, Daniela Nowak, Helmut Schmidt et Elisabeth Hitter pour leur excellente assistance technique. Soutien financier Baxter Innovations GmbHSupplément de parrainage Cet article a été publié dans le cadre d’un supplément intitulé «Le besoin d’une nouvelle maladie de Lyme Vaccin contre les maladies, « sponsorisé par Baxter Laboratories, les Centers for Disease Control, Fort Collins, CO, et Stanley Plotkin Conflits d’intérêts potentiels IL, MO’R, AT, HS-D, BAC et NB sont des employés de Baxter Innovations GmbH JJD et BJL détiennent le brevet pour certaines propriétés intellectuelles utilisées dans le développement du vaccin Référence